Indra's Research

Week 14:

Completed Enzyme and Vary Substrate Assays on YopH protein
Cleaned lab
Turned in final Research Report
Turned in Lab Notebook

Week 12-13:

Attempted ten times to complete Protein Expression Protocol
Determined that pNIC-Bsa4 clone had become linearized and was not the correct length (determined by gel check)
Fig. 1: Image of Agarose gel that determined pNIC-Bsa4 clone was linearized.

Week 11:

Ran secondary job in HF9 Library, got good fitness scores in the high 80's
Ran first job in cb_306 library, did not get any good fitness scores so did not proceed with a secondary job
Ran first job in CB-Kin library, got good fitness scores in high 70's and low 80's. Running secondary job this week
Completed Materials & Methods for Virtual Screening paper
Began Protein Expression Protocol.

Week 10:

Ran first job in HF9 Library, set up secondary run, but due to the lack of licenses it has not been able to run yet
Set up first run for CB_306 Library, but due to the lack of licenses it has not been able to run yet
Completed Materials and Methods for Cloning paper

Week 9:

Created a Homology Model for Shigella flexneri using Escherichia blattae acid phosphatase as a model. Had 93% similarity to Shigella flexneri apyrase
Fig. 1: Homology Model overlap of 1D2T (green) and Shigella apyrase (blue)
Got results back from DNA Sequencing, BLAST'ed sequences against Codon Optimized Sequence and determined that cloning was successful
Proceed into Expression with IS4-for - Indra - good deal. Be sure to note that you will have to transform it into BL21(DE3) cells first. Also grow up some in DH5alpha and do miniprep to keep an archival sample of your vector. - Dr. B
Started Virtual Screening, ran first job
Used ICM to minimize Shigella apyrase locally and make it usable by GOLD

Week 8:

Grew up Master Plate successfully.
Had growth in each of the 8 tubes that were grown up over night
Miniprep samples that were grown up over night
Fig. 1: Master Plate of colonies. Area 1 was voided because I accidentally threw away the toothpick used to transfer the colonies
Fig. 2: Nanodrop of my first sample, IS1
Fig. 3: Nanodrop of IS2
Fig. 4: Nanodrop of IS3
Fig. 5: Nanodrop of IS4
Fig. 6: Nanodrop of IS5
Fig. 7: Nanodrop of IS6
Fig. 8: Nanodrop of IS7
Fig. 9: Nanodrop of IS8
Took samples to DNA Sequencing.

Week 7:

Completed the Transformation and Annealing step of pNIC-Bsa4 cloning protocol
Set up Master Plate using Master Plate protocol and 8 tubes for samples
Fig. 1: Tube A of Transformation and Annealing Step. There were not as many colonies on this plate

Week 6:

Finished Virtual Screening and PyMol Refresher
Prepared pNIC-Bsa4 as an accepting vector
Attempted to complete the Transformation and Annealing step of the protocol, but failed

Fig 1: Results of Transformation and Annealing Step for Tube B. I believe this failed because I used the wrong Polymerase Buffer

Fig 2: Results of Transformation and Annealing Step for Tube A. I believe this failed because I used the wrong Polymerase Buffer

Week 5:

Nanodrop samples from PCR on 9/25/11, got a concentration of 7.8 ng/uL
Ran the 1st PCR in Protocol for pNIC-Bsa4 cloning off of Cloning Vector with updated PCR protocol. I used a concentration of approximately 75 ng/uL of my. I also added more cycles to the PCR protocol, increased the number from 20 to 30 additional cycles.
Nanodrop samples from PCR with 75 ng/uL concentration. Moving on to transformation with this PCR product.
Prepared pNIC-Bsa4 as Accepting Vector. Nanodrop samples, did not gel check.
Fig 1: Nanodrop results from 9/25/11. Concentration was too low, so I had to run the protocol again.
Fig 2: Gel Check of PCR that had 75 ng/uL of plasmid and had 10 additional cycles on PCR.
Fig 3: Nanodrop of PCR product with 75 ng/uL of plasmid
Fig 4: Nanodrop results of Preparation of pNIC-Bsa4 as Accepting Vector

Week 4:

Ran the 1st PCR in Protocol for pNIC-Bsa4 cloning off of Cloning Vector with updated PCR protocol. I used the concentrations stated in the protocol
Ran the 1st PCR in Protocol for pNIC-Bsa4 cloning off of Cloning Vector with updated PCR protocol. However I used different concentrations than what the protocol stated.
Fig 4: Gel check of updated PCR. I used very high concentrations of pUC-19 vector (110 ng/uL).

Week 3:

Ran Gel Check for 1st PCR in pNIC-Bsa4 cloning off of pUC-19 again. However this was not successful because lines were not in correct place due to the fact that the PCR protocol was off.
Fig. 2: Gel Check of PCR for pNIC-Bsa4 cloning. This time, it was deduced that the wrong PCR protocol was being used.

Week 2:

Ran PCR for cloning for pNIC-Bsa4 cloning off of pUC-19
Fig 1: Gel Check of PCR for pNIC-Bsa4 Cloning. Unfortunately the PCR failed, possibly because I took too long to complete the process
Prepared pNIC-Bsa4 as Accepting Vector.
Remade forward primer

Transformation Efficiency Lab:

Figure 1: A culture from the attempt to create recombinant E. Coli by introducing the plasmid pGBR22. These cells were recombined in Tube A using 1 ng of recombined pGBR22 plasmid

Figure 2: A culture from the attempt to create recombinant E. Coli by introducing the plasmid pGBR22. These cells were recombined in Tube B using 5 ng of recombined pGBR22 plasmid

Figure 3: A culture from the attempt to create recombinant E. Coli by introducing the plasmid pGBR22. These cells were recombined in Tube C using 25 ng of recombined pGBR22 plasmid

RE Digest:

Fig. 4 :Lane 2 has 1kb DNA ladder, Lane 3 has uncut plasmid, Lane 4 has sample 1 with EcoRI, Lane 5 has sample 2 with PvuII, and Lane 6 has sample 3 with EcoRI + PvuII.

PCR #1: Gel Image

Figure 5: Lane 1 contains 5 ul of 100 bp Marker. Lane 2 contains 1 uL 1:1000 dilution of stock plasmid. Lane 3 contains 10 uL of 1:1000 stock plasmid. Lane 4 contains 10 uL of 1:100 stock plasmid. Lane 5 contains no DNA (control)

PCR Gel: pCherry Results

Figure 5: Agarose Gel Analysis. Lane 1 contains 100 bp Marker. Lanes 2-5 contain Forward & Reverse Primer VDSR1 and VDSR2 respectively. Lane 2 contains 1:100000 of pmCherry. Lane 3 contains 1:10000 of pmCherry. Lane 4 contains 1:1000 of pmCherry. Lane 5 contains no DNA (control). Lane 6-9 contain M13 Forward & Reverse Primer. With the same dilutions as the previous lanes.

Indra - any thoughts on why the PCR is failing? - Dr. B

PCR Primer Design for Primer Overlap Assembly PCR:

Oligonucleotides (Primers):

1 ATGAAAACCAAAAACTTCCTGCTGTTTTGCATTGCGACCAATATGATCTTCATCC 55
2 GGTGAGGAAACCTTCTGCTTTCAGGGCGTTCGCAGACGGGATGAAGATCATATTGGTCGC 60
3 AAAGCAGAAGGTTTCCTCACCCAGCAGACCTCTCCGGATTCTCTGTCTATCCTGCCGCCA 60
4 CGCTTTGTCCGCCAGGAAAACAACAGAATCCTCCGCTGGCGGTGGCGGCAGGATAGACAG 60
5 CCTGGCGGACAAAGCGCACTACGAATTTGGTCGTTCTCTCCGTGACGCGAACCGCGTTCG 60
6 AAGGCGAGACCGAAGTTCTCGTAGTACGCATCTTCAGACGCCAGACGAACGCGGTTCGCG 60
7 AGAACTTCGGTCTCGCCTTCTCTGACGCGTACGGTATGGACATCTCTCGTGAAAACACCC 60
8 AGTCCTGCAGTACCTGGGTCAGCAGCTGGTACAGGATCGGGGTGTTTTCACGAGAGATGT 60
9 CCCAGGTACTGCAGGACTCTCATGACTATGCTGTTCGCAACGCTAAAGAATACTACAAAC 60
10 AGGTCGCGTCTTTGTAGATAACGAACGGGCGAACACGTTTGTAGTATTCTTTAGCGTTGC 60
11 TTATCTACAAAGACGCGACCTGCACCCCGGATAAAGACGAAAAAATGGCGATCACCGGTT 60
12 CGCAACCGCCCAACCGAAGCTCGCGTGACCGGACGGGTAAGAACCGGTGATCGCCATTTT 60
13 GGTTGGGCGGTTGCGCTGATCCTGGCAGAAATCAACCCGCAGCGTAAAGCGGAAATCCTG 60
14 CGCAGATAACACGAGATTCACCGAACTCGTAACCACGACGCAGGATTTCCGCTTTACGCT 60
15 GTGAATCTCGTGTTATCTGCGGCGCACACTGGCAGTCCGACGTTGAAGCGGGTCGTCTGA 60
16 AATTCCGGCGTGTTGTGCAGCACCGCAACTACAGACGCACCCATCAGACGACCCGCTTCA 60
17 GCACAACACGCCGGAATTCACCAAATCTCTGAGCGAAGCGAAGAAAGAATTCGAAGAACT 60
18 TTACGGGGTCAGTTCGTTGGTCGGAGTGTTCAGTTCTTCGAATTCTTTCTTCGC 54

Research Page- Indra